Monday, 23 February 2015

Sample And Analysis of Cereulide Toxin from Bacillus cereus in Rice

Bacillus cereus


Revision History: January 2012: The Bacillus Chapter has been updated with the inclusion of a new optional chromogenic agar, Bacara agar, for the detection and enumeration of Bacillus cereus in foods.

Bacillus cereus is an aerobic spore-forming bacterium that is commonly found in soil, on vegetables, and in many raw and processed foods. B. cereus food poisoning may occur when foods are prepared and held without adequate refrigeration for several hours before serving, with B. cereus reaching >106 cells/g. Foods incriminated in past outbreaks include cooked meat and vegetables, boiled or fried rice, vanilla sauce, custards, soups, and raw vegetable sprouts. Two types of illness have been attributed to the consumption of foods contaminated withB. cereus. The first and better known is characterized by abdominal pain and non-bloody diarrhea; it has an incubation period of 4-16 h following ingestion with symptoms that last for 12-24 h. The second, which is characterized by an acute attack of nausea and vomiting, occurs within 1-5 h after consumption of contaminated food; diarrhea is not a common feature in this type of illness1. The MYP agar has been the standard media for plating B. cereus, but it has little selectivity so background flora is not inhibited and can mask the presence of B. cereus. Bacara is a chromogenic selective and differential agar that promotes the growth and identification of B. cereus, but inhibits the growth of background flora. The chromogenic agar has been suggested for the enumeration of B. cereus group as a substitute for MYP1,2. Typical colonies will grow as pink-orange uniform colonies surrounded by a zone of precipitation. The identification would include all species from the B. cereusgroup: B. cereus, B. thuringiensis, B. anthracis,B. mycoides, and B. weihenstephanensis. Biochemical testing will be necessary to delineate to the species level. The Bacara media can be purchased as prepared plates or media in flasks to which two supplied reagents are added. The media has a proprietary formulation and cannot be purchased in a dehydrated form.
Examination of Foods for B. cereus
  1. Sampling
    If the quantity of food to be examined is large, take representative samples of 50 g each from different parts of the suspect food because contamination may be unevenly distributed. If the food is a powder or consists of small discrete particles, then it should be thoroughly mixed before taking samples.
  2. Transporting and storage of samples
    Transport samples promptly in insulated shipping containers with enough gel-type refrigerant to maintain them at 6°C or below. Upon receipt in the laboratory, store the samples at 4°C and analyze as soon as possible. If analysis cannot be started within 4 days after collection, freeze samples promptly and store at -20°C until examined. Thaw at room temperature and proceed with analysis as usual. Maintain frozen samples at -20°C until examined.  Ship on dry ice to avoid thawing. Dehydrated foods may be stored at room temperature and shipped without refrigeration.
Enumeration and Confirmation of B. cereus in Foods
  1. Equipment and materials
    1. See Chapter 1 of FDA BAM for preparation of food homogenate
    2. Pipets, 1, 5, and 10 ml, graduated in 0.1 ml units
    3. Glass spreading rods (e.g., hockey stick) 3-4 mm diameter with 45-55 mm spreading area
    4. Incubators, 30 ± 2°C and 35 ± 2°C
    5. Colony counter
    6. Marking pen, black felt type
    7. Large and small Bunsen burners
    8. Wire loops, No. 24 nichrome or platinum wire, 2 mm and 3 mm id
    9. Vortex mixer
    10. Microscope, microscope slides, and cover slips
    11. Culture tubes, 13 × 100 mm, sterile
    12. Test tubes, 16 × 125 mm, or spot plate
    13. Bottles, 3 oz, sterile
    14. Anaerobic jar, BBL GasPak, with H2 + CO2 generator envelopes and catalyst
    15. Water bath, 45 ± 2°C (tempering agar) 
    16. Water bath, 100 ± 2°C (melting Bacara agar prepared in flask) 
    17. Culture tube racks
    18. Staining rack
    19. Petri dishes, sterile, 15 × 100 mm 
  2. Media and reagents
    1. Bacara agar plates, chromogenic media prepared plates or flasks purchased from AES Chemunex, Cranbury, NJ.
    2. Mannitol-egg yolk-polymyxin (MYP) agar plates (M95)
    3. Egg yolk emulsion, 50% (M51)
    4. Trypticase soy-polymyxin broth (M158)
    5. Polymyxin B solutions for MYP agar (0.1%) and trypticase soy-polymyxin broth (0.15%) (see M95 andM158)
    6. Phenol red glucose broth (M122)
    7. Tyrosine agar (M170)
    8. Lysozyme broth (M90)
    9. Voges-Proskauer medium (M177)
    10. Nitrate broth (M108)
    11. Nutrient agar for B. cereus (M113)
    12. Motility medium (B. cereus) (M100)
    13. Trypticase soy-sheep blood agar (M159)
    14. Nitrite detection reagents (R48)
    15. Butterfield's phosphate-buffered dilution water (R11) sterilized in bottles to yield final volumes of 450 ± 5 ml and 90 ± 2 ml
    16. Voges-Proskauer test reagents (R89)
    17. Creatine crystals
    18. Gram stain reagents (R32)
    19. Basic fuchsin staining solution (R3)
    20. Methanol (absolute)
    21. Brain Heart Infusion Broth with 0.1% glucose for enterotoxin testing (Ch. 15). 
  3. Sample preparation
    Using aseptic technique, weigh 50 g of sample into sterile blender jar. Add 450 mL Butterfield's phosphate-buffered dilution water (1:10 dilution) and blend for 2 min at high speed (10,000-12,000 rpm). Prepare serial dilutions from 10-2 to 10-6 by transferring 10 mL homogenized sample (1:10 dilution) to 90 mL dilution blank, mixing well with vigorous shaking, and continuing until 10-6 dilution is reached.
  4. Plate count of B. cereus
    Inoculate duplicate Bacara or MYP agar plates with each dilution of sample (including 1:10) by spreading 0.1 mL evenly onto surface of each plate with sterile glass spreading rod. Incubate plates 18-24 h at 30°C and observe for colonies surrounded by precipitate zone, which indicates that lecithinase is produced. B. cereuscolonies are usually a pink-orange color on Bacara or pink on MYP and may become more intense after additional incubation (see Fig. 1).
    4 Petri dishes with titles demonstrating the difference in colony appearance when bacteria are grown on MYP medium (other organisms can grow) versus Bacara medium (other organisms inhibited)
    Fig. 1. Colonies of B. cereus grown on MYP are pink and lecithinase positive, but other bacteria are not inhibited and can interfere with isolation of B. cereus. Colonies of B. cereus grown on Bacara are pink-orange and are lecithinase positive, but other organisms are inhibited.
    If reactions are not clear, incubate plates for additional 24 h before counting colonies. Select plates that contain an estimated 15-150 pink-orange (Bacara) or pink (MYP), lecithinase-producing colonies. Mark bottom of plates into zones with black felt pen to facilitate counting and count colonies that are typical of B.cereus. This is the presumptive plate count of B. cereus. Pick at least 5 presumptive positive colonies from the Bacara or MYP plates and transfer one colony to BHI with 0.1% glucose for enterotoxin studies (Chapter 15) and a nutrient agar slant for storage.  Typical colonies grown on Bacara or MYP must be confirmed with biochemical testing as described in Sections F and H below.
    Calculate number of B. cereus cells/g of sample, based on percentage of colonies that are morphologically consistent with B. cereus. For example, if average count obtained with 10-4 dilution of sample was 65 and 4 of 5 colonies tested were confirmed as B. cereus, the number of B. cereus cells/g of food is 65 × 4/5 × 10,000 × 10 = 5,200,000. (NOTE: Dilution factor is tenfold higher than sample dilution because only 0.1 mL was tested).
  5. Most probable number (MPN) of B. cereus
    The most probable number (MPN) method is recommended for routine surveillance of products in which small numbers of B. cereus are expected5. This method is also effective in testing foods that may contain a large population of competing species or in dehydrated food products in which the potential spores would outnumber vegetative cells and require additional nutrients to germinate.
    Inoculate 3-tube MPN series in trypticase soy-polymyxin broth, using 1 mL inoculum of 10-1, 10-2, and 10-3dilutions of sample with 3 tubes at each dilution. (Additional dilutions should also be tested if B. cereuspopulation is expected to exceed 103/g.) Incubate tubes 48 ± 2 h at 30 + 2°C and observe for turbid growth, which is typical of B. cereus. Streak cultures from turbid, positive tubes onto separate agar plates (either Bacara or MYP) and incubate plates 18-24 h at 30°C. Pick one or more pink-orange (Bacara) or pink (MYP), lecithinase-positive colonies from each agar plate and transfer to BHI with 0.1% glucose for enterotoxin studies (Chapter 15) and nutrient agar slants for storage. Typical colonies grown on Bacara or MYP must be confirmed with biochemical testing as described in Sections F and G below.
    Calculate MPN of B. cereus cells/g of sample (see BAM Appendix 2) based on the number of tubes at each dilution in which the presence of B. cereus was confirmed. Biochemical testing will be necessary to delineate to the species level, however, enterotoxins can be carried by Bacillus spp. other than B. cereus.
  6. Confirmation of B. cereus
    Pick 5 or more eosin pink, lecithinase-positive colonies from MYP agar plates and transfer to nutrient agar slants. Incubate slants 24 h at 30°C. Prepare Gram-stained smears from slants and examine microscopically.B. cereus will appear as large Gram-positive bacilli in short-to-long chains; spores are ellipsoidal, central to subterminal, and do not swell the sporangium. Transfer 3 mm loopful of culture from each slant to 13 × 100 mm tube containing 0.5 ml of sterile phosphate-buffered dilution water and suspend culture in diluent with Vortex mixer. Use suspended cultures including ATCC 14579 B. cereus and ATCC 64 Brevibacillus laterosporus as positive and negative controls respectively to inoculate the following confirmatory media:
    1. Phenol red glucose broth. Inoculate 3 mL broth with 2 mm loopful of culture. Incubate tubes anaerobically 24 h at 35°C in GasPak anaerobic jar. Shake tubes vigorously and observe for growth as indicated by increased turbidity and color change from red to yellow, which indicates that acid has been produced anaerobically from glucose. A partial color change from red to orange/yellow may occur, even in uninoculated control tubes, due to a pH reduction upon exposure of media to CO2 formed in GasPak anaerobic jars.
    2. Nitrate broth. Inoculate 5 ml broth with 3 mm loopful of culture. Incubate tubes 24 h at 35°C. To test for nitrite, add 0.25 ml each of nitrite test reagents A and C to each culture. An orange color, which develops within 10 min, indicates that nitrate has been reduced to nitrite.
    3. Modified VP medium. Inoculate 5 ml medium with 3 mm loopful of culture and incubate tubes 48 ± 2 h at 35°C. Test for production of acetylmethyl-carbinol by pipetting 1 ml culture into 16 × 125 mm test tube and adding 0.6 ml alpha-naphthol solution (R89) and 0.2 ml 40% potassium hydroxide (R89). Shake, and add a few crystals of creatine. Observe results after holding for 1 h at room temperature. Test is positive if pink or violet color develops.
    4. Tyrosine agar. Inoculate entire surface of tyrosine agar slant with 3 mm loopful of culture. Incubate slants 48 h at 35°C. Observe for clearing of medium near growth, which indicates that tyrosine has been decomposed. Examine negative slants for obvious signs of growth, and incubate for a total of 7 days before considering as negative.
    5. Lysozyme broth. Inoculate 2.5 ml of nutrient broth containing 0.001% lysozyme with 2 mm loopful of culture. Also inoculate 2.5 ml of plain nutrient broth as positive control. Incubate tubes 24 h at 35°C. Examine for growth in lysozyme broth and in nutrient broth control. Incubate negative tubes for additional 24 h before discarding.
    6. MYP agar. This test may be omitted if primary inoculation media was Bacara or test results were clear-cut with original MYP agar plates and there was no interference from other microorganisms..  Mark bottom of a plate into six equal sections with felt marking pen, and label each section with sample number. Inoculate premarked 4 cm sq area of MYP agar plate by gently touching surface of agar with 2 mm loopful of culture. Allow inoculum to be fully absorbed before incubating for 24 h at 30°C. Check plates for lecithinase production as indicated by zone of precipitation surrounding growth. Mannitol is not fermented by isolate if growth and surrounding medium are eosin pink. (Yellow color indicates that acid is produced from mannitol.) B. cereus colonies are usually lecithinase-positive and mannitol-negative on MYP agar.
  7. Record results obtained with the different confirmatory tests. Tentatively identify as B. cereus those isolates which 1) produce large Gram-positive rods with spores that do not swell the sporangium; 2) produce lecithinase and do not ferment mannitol on MYP agar; 3) grow and produce acid from glucose anaerobically; 4) reduce nitrate to nitrite (a few strains may be negative); 5) produce acetylmethylcarbinol (VP-positive); 6) decompose L-tyrosine; and 7) grow in the presence of 0.001% lysozyme.
    These basic characteristics are shared with other members of the B. cereus group, including the rhizoid strains B. mycoides, the crystalliferous insect pathogen B. thuringiensis, and the mammalian pathogen B.anthracis. However, these species can usually be differentiated from B. cereus by determining specific characteristics typical of each species or variety. The tests described in G, below, are useful for this purpose and can easily be performed in most laboratories. Strains that produce atypical results from these tests require additional analysis before they can be classified as B. cereus.
  8. Tests for differentiating members of the B. cereus group (Table 1)
    The following tests are useful for differentiating typical strains of B. cereus from other members of the B.cereus group, including B. mycoides, B. thuringiensis, and B. anthracis also non-motile.
    1. Motility test. Inoculate BC motility medium by stabbing down the center with 3 mm loopful of 24 h culture suspension. Incubate tubes 18-24 h at 30°C and examine for type of growth along stab line. Motile organisms produce diffuse growth out into the medium away from the stab. Non-motile organisms produce growth only in and along stab. Alternatively, add 0.2 mL sterile distilled water to surface of nutrient agar slant and inoculate slant with 3 mm loopful of culture suspension. Incubate slant 6-8 h at 30°C and suspend 3 mm loopful of liquid culture from base of slant in a drop of sterile water on microscope slide. Apply cover glass and examine immediately with microscope for motility. Report whether or not isolates tested were motile. Most strains of B. cereus and B. thuringiensis are motile by means of peritrichous flagella. B. anthracis and all except a few strains of B. mycoides are non-motile. A few B. cereus strains are also non-motile.

    Table 1. Differential characteristics of large-celled Group I Bacillus species
    FeatureB. cereusB. thuringiensisB. mycoidesB. weihenstephanensisB. anthracisB. megaterium
    Gram reaction+(a)+++++
    Catalase++++++
    Motility+/−(b)+/−−(c)+−+/−
    Reduction of nitrate+++++−(d)
    Tyrosine decomposed+++/−+−(d)+/−
    Lysozyme-resistant+++++−
    Egg yolk reaction+++++−
    Anaerobic utilization of glucose+++++−
    VP reaction+++++−
    Acid produced from mannitol−−−−−+
    Hemolysis (Sheep RBC)+++ND−(d)−
    Known pathogenicitye
    /characteristic
    produces enterotoxinsendotoxin crystals
    pathogenic to insects
    rhizoidal growthgrowth at 6°C;
    no growth at 43°C
    pathogenic to animals and humans
    a +, 90-100% of strains are positive.
    b +/−, 50-50% of strains are positive.
    c −, 90-100% of strains are negative.
    d −, Most strains are negative.
    e See Section H, Limitations of method for B. cereus.
    ND Not determined 

    1. Rhizoid growth. Pour 18-20 mL nutrient agar into sterile 15 × 100 mm petri dishes and allow agar to dry at room temperature for 1-2 days. Inoculate by gently touching surface of medium near center of each plate with 2 mm loopful of 24 h culture suspension. Allow inoculum to be absorbed and incubate plates 48-72 h at 30°C. Examine for development of rhizoid growth, which is characterized by production of colonies with long hair or root-like structures that may extend several centimeters from site of inoculation. Rough galaxy-shaped colonies are often produced by B. cereus strains and should not be confused with typical rhizoid growth, which is the definitive characteristic of B. mycoides. Most strains of this species are also non-motile.
    2. Test for hemolytic activity. Mark bottom of a plate into 6-8 equal sections with felt marking pen, and label each section. Inoculate a premarked 4 cm sq area of trypticase soy-sheep blood agar plate by gently touching medium surface with 2 mm loopful of 24 h culture suspension. (Six or more cultures can be tested simultaneously on each plate.) Incubate plates 24 h at 35°C. Examine plates for hemolytic activity. B. cereus cultures usually are strongly hemolytic and produce 2-4 mm zone of complete (β) hemolysis surrounding growth. Most B. thuringiensis and B. mycoides strains are also β-hemolytic. B.anthracis strains are usually nonhemolytic after 24 h incubation.
    3. Test for protein toxin crystals. Inoculate nutrient agar slants with 3 mm loopfuls of 24 h culture suspensions. Incubate slants 24 h at 30°C and then at room temperature 2-3 days. Prepare smears with sterile distilled water on microscope slides. Air-dry and lightly heat-fix by passing slide through flame of Bunsen burner. Place slide on staining rack and flood with methanol. Let stand 30 s, pour off methanol, and allow slide to air-dry. Return slide to staining rack and flood completely with 0.5% basic fuchsin or TB carbolfuchsin ZN stain (Difco). Heat slide gently from below with small Bunsen burner until steam is seen.
      Wait 1-2 min and repeat this step. Let stand 30 s, pour off stain, and rinse slide thoroughly with clean tap water. Dry slide without blotting and examine under oil immersion for presence of free spores and darkly stained tetragonal (diamond-shaped) toxin crystals. Crystals are usually somewhat smaller than spores. Toxin crystals are usually abundant in a 3- to 4-day-old culture of B. thuringiensis but cannot be detected by the staining technique until lysis of the sporangium has occurred. Therefore, unless free spores can be seen, cultures should be held at room temperature for a few more days and re-examined for toxin crystals. B. thuringiensis usually produces protein toxin crystals that can be detected by the staining technique either as free crystals or parasporal inclusion bodies within the exosporium. B. cereusand other members of the B. cereus group do not produce protein toxin crystals.
    4. Test for psychrotolerant strains. To determine psychrotolerance streak out two TSA plates. Incubate one plate at 6°C for 28 days and the second at 43°C for 4 days. B. weihenstephanensis will grow at 6°C but not at 43°C.
    5. Interpreting test results. On the basis of the test results, identify as B. cereus those isolates which are actively motile and strongly hemolytic and do not produce rhizoid colonies or protein toxin crystals. Nonmotile B. cereus strains are also fairly common and a few strains are weakly hemolytic. These nonpathogenic strains of B. cereus can be differentiated from B. anthracis by their resistance to penicillin and gamma bacteriophage. CAUTION: Nonmotile, nonhemolytic isolates that are suspected to be B. anthracis should be submitted to a pathology laboratory such as the Centers for Disease Control and Prevention, Atlanta, GA, for identification or destroyed by autoclaving. Acrystalliferous variants of B.thuringiensis and nonrhizoid strains derived from B. mycoides cannot be distinguished from B. cereus by the cultural tests.
    6. Limitations of method for B. cereus. The method described is intended primarily for use in the routine examination of foods. As noted in F above and in Table 1, the confirmatory tests recommended may in some instances be inadequate for distinguishing B. cereus from culturally similar organisms that could occasionally be encountered in foods. These organisms include 1) the insect pathogen B.thuringiensis, which produces protein toxin crystals; 2) B. mycoides, which characteristically produces rhizoid colonies on agar media; and 3) B. anthracis, which exhibits marked animal pathogenicity and is non-motile. With the exception of B. thuringiensis, which is currently being used for insect control on food and forage crops, these organisms are seldom encountered in the routine examination of foods. The tests described above are usually adequate for distinguishing the typical strains of B. cereus from other members of the B. cereus group. However, results with atypical strains of B. cereus are quite variable, and further testing may be necessary to identify the isolates.

References
  1. Stenfors, Arnesen LP, Fagerlund A, Granum PE. (2008) From Soil to gut: Bacillus cereus and its food poisoning toxins. FEMS Microbiol Rev. 32: 579-606.
  2. Tallent, SM, KM Kotewicz, EA Strain and RW Bennett. 2012. Efficient Isolation and Identification of Bacillus cereus Group disclaimer icon.  Journal of AOAC International, 95(2): 446-451.  Available as PDF (278 Kb)
  3. Anonymous. (1993) 2nd Ed., International Organization for Standardization, Geneva, Switzerland, MethodISO 793.

Introduction Food poisoning in Malaysia

Introduction Food poisoning is caused with presence of bacteria in food due to improper food preparation or cooking process and exposure of food to temperatures of 30o C. Common food poisonings are usually mild, but deaths due to food poisoning are also reported. Food poisoning occurs within 48 hours after consumption of contaminated food or drink. The symptoms include nausea, vomiting, diarrhea and abdominal pain. Most cases of food poisoning are caused by bacteria, viruses or toxins and chemicals (Drobniewski, 1993). Milk, dairy products, fatty foods, bread, cakes and seafood can easily be contaminated with Bacillus spp. Bacillus cereus (B. cereus) can cause food poisoning. This bacterium is ubiquitous in nature and can be found in soil or in a variety of dried foods such as grains, legumes, starches and spices as vegetative cells and endospores (Rusul and Yaacob, 1995).

According to Food and Drug Administration of the United Stated, food poisonings due to B. cereus group have two different clinical syndromes, diarrheal and emetic (vomiting) syndrome. The emetic type causes vomiting after 0.5–6 h of ingestion (Ehling-Schulz et al., 2005) and diarrhoeal type causes abdominal pain and diarrhoea after 8 to 16 h of consumption. The diarrheal syndrome has been associated with a wide variety of food including meats, milk, vegetables and fish while the emetic syndrome has been generally associated with rice products, starchy foods such as potato, pasta, noodles, spaghetti, pastry and cheese products (Granum and Lund, 1997, Shinagawa 1993). Based on the report of European Food Safety Agency (2005) 1–33% of food-borne poisonings are caused by B. cereus. Bean and Griffin (1990) reported that B. cereus was responsible for 58 foodborne outbreaks in the United States from 1973- 1987, representing approximately 3% of the total outbreaks. About 27,360 cases of food-borne illness reported in 1997 were from B. cereus (Mead et al., 1999). Michael et al., 2006, reported that 571 cases of food-borne poisonings in US (between 1998 to 2002) were due to B. cereus contamination. In Korea, B. cereus was responsible for 15 food-borne outbreaks (392 patients) accounting 5.5% of the total outbreaks in 2009 (Chang et al,. 2011).

B. cereus is the cause of “Fried Rice Syndrome” as endospores of this bacterium can survive in improperly cooked rice and this problem is exacerbated when foods are stored in ambient temperature. This situation gives enough time for endospores to germinate (Rusul and Yaacob, 1995). Nowadays, rice is regarded as the most important staple food for human population in the world especially in Africa, Southeast Asia, the Middle East, Latin America and the West Indies (Boyce et al., 1996). About 85% consumption and production of total rice in the world are in Asian countries (Shoichi et al., 1989). Therefore, it is crucial to assure the safety of rice products, especially when the cooked products are stored prior to consumption. Incidences of B. cereus food poisoning due to consumption of improperly handled boiled rice have been reported. In most of the cases the mentioned food-borne outbreaks came from Chinese restaurants or takeaway shops which left the boiled rice to dry off at room temperature (Lee et al., 1995). A recent study on microbiological quality of take-away cooked rice in London showed that 10% of the samples were unsatisfactory and 3% of the samples were in unacceptable quality ( > 105 CFU/g) due to presence of B. cereus and/or other Bacillus spp. (Little et al., 2002). In Virginia in1993, a regional public health facility received a report of acute gastrointestinal illness. It was reported in a day-care center where 14 out of 48 persons consuming chicken fried rice had shown acute gastrointestinal symptoms. Chicken fried rice was prepared by a local restaurant and the rice had been cooked one day before and cooled at room temperature before refrigeration. In the morning, the rice which was pan-fried in oil with pieces of cooked chicken was delivered to the day-care center at 10:30 a.m. and without refrigeration or reheating was served at noon. In the mentioned outbreak, vegetative form of the microorganism probably multiplied at the restaurant and the day-care centers while the rice was held at room temperature (Todar, 2009). 

In Malaysia, the first outbreak of food poisoning due to B. cereus was reported by Rampal (1984). The outbreak affected 114 Malay students staying at a hostel of a religious secondary school in Klang. The students consumed fried noodles and the illness was characterized by abdominal pain, nausea, vomiting and giddiness. Every year food poisoning outbreaks from the school canteen are reported in Malaysia. In 2010, 50 % percent of the total reports (311 cases) of food poisoning incidents were from school canteens. The source of food poisoning was contaminated nasi lemak (Utusan online, 2011). Johore Weekly Epidemiological Bulletin reported that there had been 1776 cases of food poisoning in Malaysia until July 2011. Food poisoning occurred after the victims consume ready-to-eat cooked rice (such as nasi lemak and nasi briyani) kept in at room temperature. The symptoms were reported as abdominal pain, diarrhoea, nausea and vomiting (Fatimah et al., 2011). Some of B. cereus outbreaks are under reporting as the illness associated with this bacteria limit itself and does not become severe. A recent survey on culture practices for outbreaks of apparent food-borne illness showed that 20% of state public health laboratories do not make B. cereus testing routinely available.

The survey also found that most of food handlers (in food stalls and restaurants) were unaware that cooked rice was a potentially hazardous food (Todar, 2009). B. cereus is a facultatively anaerobic, sporeforming and gram-positive bacterium. Differentiation of B. cereus from its closely related microorganism, Bacillus thuringiensis (B. thuringiensis), depends upon the absence of toxin crystals (Yamada et al., 1999). Nowadays B. thuringiensis is recognized as bacteria with the ability to produce diarhoeal toxin, whereas in the past decades it was used as biocontrol agent due to its ability to kill insect (Oh et al., 2011). B. cereus and B. thuringiensis are highly polyphyletic (Guinebretiere et al., 2008) and have similarity in genotype and phenotype (Oh et al., 2011). Ash et al. (1991a; 1991b) compared the members of B. cereus groups using 16S rRNA genes and concluded that four members of the B. cereus group (B. cereus, B. thuringiensis, B. mycoides and B. anthracis) can be considered one species as they are closely related. Yamada et al, (1999), detected B. cereus and B. thuringiensis using gyrase B (gyrB) gene in PCR assay. Currently, polymerase chain reaction (PCR) is a popular tool for rapid detection of pathogens. The Most Probable Number (MPN) method is widely used as a routine analysis technique to enumerate bacteria in foods. This method allows quantitative data to be calculated from incidence results and is effective for both low and high cell counts (Blodgett, 2006). MPN-PCR has been successfully used for quantitative determination of pathogens in foods (Bach et al., 2002). In Malaysia, some studies on biosafety of B. cereus have been carried out (e.g. ready to eat cereals, chocolate, honey, milk by Lee et al., (2009); noodles, spices, grains and legumes by Rusul and Yaacob in 1995). There has been no study on the occurrence of B. cereus and B. thuringiensis in rice products in Malaysia. The aim of this study was to isolate B. cereus and B. thuringiensis from rice and determine their prevalence using a combination of Most Probable Number - Polymerase Chain Reaction (MPN-PCR) method. Materials and Methods Sample Collection A total of 115 cooked rice samples were collected randomly from restaurants and retail food stores in Selangor, Malaysia. The cooked rice samples were as follows: nasi lemak (rice cooked in coconut milk), nasi briyani (Persian rice), nasi ayam (chicken rice) and nasi putih (white rice). All samples were transported to the laboratory immediately and analyzed within 24 h of sample collection. Twenty five raw rice samples from 5 local varieties (Keladi halus wangi, Keladi wangi, Kanowit halus wangi, Lansam halus wangi and Bario) were obtained from Sarawak, Malaysia. Sample preparation Samples were analyzed using the standard procedure for detection of B. cereus (Rhodehamel and Harmon, 2001) with modifications described by Lee et al. (2009). Briefly, 10 g of each sample was placed in a stomacher bag added with 90 ml of Tryptic Soy Broth (TSB; BactoTM, France) and pummeled in a stomacher (Interscience, France) for 60 s followed by incubation at 37°C for 12 h. MPN- Multiplex PCR For MPN analysis, 100 fold and 1000 fold dilutions of the stomached fluid were prepared with Tryptic Soy Broth (TSB; BactoTM, France). 0.1 ml portions of each dilutions of the fluid were transferred into three tubes and the tubes were incubated at 37°C for 18 to 24 h. A loopful of culture from each tube was streaked onto Mannitol Egg Yolk Polymyxin Agar Base (MYP; DifcoTM) added with sterile Polymyxin B Selective Supplement (DifcoTM, Germany) and sterile Egg-Yolk Tellurite Emulsion 20% (Merck, Germany) which is a specific media for the isolation and identification of the Bacillus species. DNA extraction Prior to PCR analysis, the content of MPN tubes were preceded to DNA extraction using boil cell method (Lee et al., 2009) with slight modifications. A 1 ml portion of each MPN broth was subjected to centrifugation at 12,000 x g for 1 min and the pellet was resuspended in 500 μl of sterile distilled water. The mixture was boiled for 20 min and immediately cooled at -20°C for 10 min before it was centrifuged at 12,000 x g for 5 min. The supernatant was used for detection of B. cereus and B. thuringiensis using PCR. Primers and PCR conditions For detection of B. cereus and B. thuringiensis the following primer pairs were used. BCJH-F (5’ TCATGAAGAGCCTGTGTACG 3’) and BCJH- 1R (5’ CGACGTGTCAATTCACGCGC 3’) were used to amplify a 475 bp fragment of gyrase B (gyrB) gene to detect B. cereus. BTJH-1F (5’ GCTTACCAGGGAAATTGGCAG 3’) and BTJH-R (5’ ATCAACGTCGGCGTCGG 3’) were used to amplify a 299 bp fragment of gyrB gene to detect B. thuringiensis (Park et al., 2007). Multiplex PCR amplification was performed in a 20 µl reaction mixture containing 5.0 µl of 5X PCR buffer, 1.5 mM MgCl2 , 0.2 mM of deoxynucleoside triphosphate mix, 1.0 µM of each primers, 0.2 U/µl Taq polymerase and 2.0 µl of DNA template. All PCR reagents were supplied by Promega and the primers were synthesized by Invitrogen. Amplification was performed on a Veriti 96-Well Thermal Cycler (Applied Biosystems, CA, USA) with the following conditions: initial denaturation at 94°C for 3 min for 1 cycle, 35 cycles consisting of denaturation at 94°C for 45 s, annealing at 63°C for 1 minute and elongation at 72°C for 1 min, and a final extension at 72°C for 7 min. PCR products were electrophoresed on a 1.0% agarose gel at 80V for 40 min. A 100 bp DNA molecular ladder (Vivantis Technologies) was included in each gel. The agarose gel was stained with ethidium bromide and visualized under UV light using Gel Documentation System (SynGene). Data analysis All measurements were carried out in triplicate. SPSS (v. 19) statistical package was used to determine if there was any significant difference (P < 0.05 ) between prevalence of B. cereus and B. thuringiensis in cooked rice samples. Results Figure 1 shows the result of PCR amplification for detection of B. cereus in raw rice samples and Fig. 2 represent the results of multiplex PCR amplification for detection of B. cereus (with product size of 475 bp) and B. thuringiensis (with product size of 299 bp) in cooked rice samples. Prevalence of B. cereus and B. thuringiensis in cooked rice samples are summarized in Table 1. The total prevalence of B. cereus and B. thuringiensis were found to be 73.04% and 24.3% , respectively. Raw rice samples (n = 25) were contaminated only with B. cereus and no contamination with B. thuringiensis was observed (Table 2 and Fig. 1). Figure 1. Representative amplification of the gyrB gene for the detection of B. cereus (475 bp) in raw rice. Lane M: 100 bp DNA ladder; Lane 1: positive control at 475 bp; Lane 2 – 5 and 7-9 : positive samples; Lane 6: negative control. Figure 2. Multiplex PCR products for detection of B. cereus and B. thuringiensis in cooked rice. Lane M: 100 bp DNA ladder; Lane 1: positive control; Lane 2: negative control; Lane 3 - 11: positive samples. MPN-PCR results revealed that nasi ayam was significantly different (P < 0.05 ) from others in term of B. cereus contamination. Nasi ayam had the highest contamination level (100%) with B. cereus, followed by nasi putih (76.2%), nasi lemak (70.4%) and nasi briyani (50%). Besides, nasi lemak was the most contaminated sample (35.2%) with B. thuringiensis followed by nasi briyani (30%), nasi ayam (10%) and nasi putih (10%). Occurrence of B. cereus and B. thuringiensis in the samples are listed in Tables 3 and 4. Occurrence of B. cereus and B. thuringiensis in the samples ranged from < 3 to 1100 MPN/g in different samples. The minimum number of B. cereus in samples is 3 MPN/g for nasi lemak and nasi ayam. B. cereus contamination was found to be 3.6 MPN/gr for nasi putih and 9 MPN/g for nasi briyani. Minimum number of B. thuringiensis was found to be 3 MPN/g for nasi lemak; followed by 3.6, 9.2 and 19 MPN/g for nasi ayam, nasi putih and nasi briyani, respectively. Maximum number of B. cereus was observed in nasi lemak, nasi briyani and nasi putih ( > 1100 MPN/g) while nasi ayam showed less contamination (460 MPN/g) with B. cereus which was significantly different (P < 0.05 ) from others (Table 3). Maximum number for B. thuringiensis contamination varied in different cooked rice samples. The maximum number of B. thuringiensis in nasi lemak, nasi briyani, nasi putih and nasi ayam were found to be >1100, 93, 9.2 and 3.6 MPN/g, respectively (Table 4). The minimum numbers of B. cereus in raw rice samples were 3, 3.6, 6 and 150 MPN/g for keladi halus wangi, keladi wangi, kanowit halus wangi, lansam halus wangi and Bario, respectively. The maximum numbers of B. cereus were found in keladi halus wangi and lansam halus wangi ( >1100 MPN/g). Bario, keladi wangi and kanowit halus wangi were contaminated with B. cereus as follows: 1100, 53 and 13 MPN/g, respectively. All raw rice samples were negative for B. thuringiensis (Tables 3 and 4). Discussion As mentioned before, B. cereus and B. thuringiensis have similarity in genotype and phenotype (Oh et al., 2011). Yamada et. a.l, (1999), detected B. cereus and B. thuringiensis using gyrase B (gyrB) gene in PCR assay. In this study the same gene was targeted for detection of B. cereus and B. thuringiensis and the results were in agreement with their findings. According to the results, nasi ayam showed the highest frequency of B. cereus (100%). Nasi ayam is steamed rice with chicken soup, added with some spices (such as ginger and garlic). The chicken soup and spices can contribute to the contamination of nasi ayam with B. cereus, resulting in high contamination level of B. cereus (Rusul and Yaacob, 1995; te Giffel et al., 1996). 

Besides, the nasi ayam that is served in restaurants, Chinese coffee shops, school canteen and food stalls is usually cooked in bulk. In Malaysia, nasi ayam is commonly served in open trays and is held at room temperature (28-30o C) for several hours. Such conditions allow the germination of B. cereus spores.
 Nasi lemak is boiled in coconut cream added with some spices. It is traditionally wrapped in banana leaves with cucumber slices, small fried anchovies (ikan bilis), roasted peanuts, hardboiled egg, and hot spicy sauce (sambal). All mentioned ingredients act as potential sources of B. cereus cross contamination. This idea is supported by Rosenquist et al. (2005), who found that cucumber is naturally contaminated with B. cereus. Although nasi putih is plain rice (without any spices or additional ingredient), it was found to be contaminated with B. cereus. Contaminated raw rice which has not been washed /or improperly washed before cooking can result in contamination of cooked rice, as B. cereus spores can survive cooking temperature or heat treatment process. As mentioned before, cooked rice is displayed and served at room temperature that allows the spores of B. cereus to grow (Koo et al., 1998, Todar, 2009). In tropical countries, such as Malaysia, the scenario is more severe due to high temperature. Other sources for Bacillus contamination are dirty hands or cooking stuffs (e.g. knife), handling foods without gloves and flies/insects contamination (Singleton, 2004). Therefore it is recommended to educate food handlers about their responsibilities for food safety and train them on personal hygiene policies and basic practices for safe food handlings. The safe methods for readyto-eat foods such as cooked rice are: 1) to keep the food at hot temperature (at least at 60o C) 2) or it can be cooked as quickly as possible and then keep at low temperature ( < 5o C ) for later use. Temperature range of 5 - 60o C will allow B. cereus to germinate and produce toxin. Although 100% of nasi ayam samples were positively contaminated with B. cereus, none was contaminated more than 104 cells which is the unsatisfactory level according to Guidelines for Assessing the Microbiological Safety of Ready-toEat Foods, 2009. According to Grande et al. (2006), not every contaminated food can cause food-borne illness as B. cereus can only produce toxin in desired conditions/or the bacteria may be found in low numbers not enough for causing symptoms. It was found that 50% of nasi putih and 40% of nasi briyani contained more than104 cell of B. cereus. According to Oh and Cox (2010), B. cereus spores can survive boiling and cooking process. If raw rice is contaminated with high level of B. cereus spores, the spores will germinate and produce toxin after cooking and during storage at inappropriate temperature. Rice served for breakfast is normally cooked at dawn and displayed in open containers. In such a case the food may easily get contaminated and cause food-borne disease (Daanam et al., 1999). Results showed that the level of contamination with B. thuringiensis was <103 cell in cooked rice samples (satisfactory according to Guidelines for Assessing the Microbiological Safety of Ready-toEat Foods, 2009). Koo et al. (1998) had a similar observation and stated that typically the bacterial spores exist in low numbers and remain inactive in food. Ankolekar et al. (2009) found 46.6% of the rice samples to be positive for B. cereus with the range of 3.6 to 460 CFU/g and 6.1% positive for B. thuringiensis with level of 3.6 - 23 CFU/g. It is likely in contrast with present study as it was found that 100% of raw rice samples were positive for B. cereus but negative for B. thuringiensis. Although in both studies MPN method was used for isolation and enumeration, different methods were used for confirmation of the results. Ankolekar et al. (2009) used conventional method while current study used PCR assay. In addition, it was found that 20% of raw rice samples were contaminated with B. cereus with a level of >104 cells. The finding is in agreement with observations of te-Giffel et al. (1996) (reported B.cereus in pasta) and Fang et al. (2003) (studied B.cereus in rice products and ready-to-eat foods). According to Guinebretiere et al., 2008, B. cereus has the growth temperature of 4°C to 50°C. Unfortunately the temperature that ready-to-eat foods are usually kept (room temperature) supports the growth of bacteria. On the other hand, interactions between bacteria is an important factor. All cooked rice samples were contaminated with B. cereus. The finding is supported by Oh and Cox, 2010, who reported that in rice-based foods B. cereus was the dominant bacterium. The reason is that spores of B. cereus have little or no competition with vegetative cells as vegetative cells are killed or suppressed by heating treatment and storage temperature (Granum, 2007). Growth and proliferation of B. cereus seemed to be greater than B. thuringiensis (Fig. 3) in most of the samples. Eilenberg et al. (2000) reported that B. thuringiensis is able to growth and proliferate in suitable condition, but multiplication of this bacterium is inhibited by the presence of other pathogens. Nowadays B. thuringiensis is recognized as bacteria with the ability to produce diarhoeal toxin, whereas in the past decades it was used as biocontrol agent due to its ability to kill insect. Therefore, it is important to make sure that when B. thuringiensis is used as a bioinsecticide it does not produce the diarrheal toxin (Oh et al., 2011). Conclusion Raw and cooked rice were found to be contaminated with B. cereus. The spores of this microorganism will not be destroyed by heat treatment (such as boiling or frying). Keeping foods at ambient temperature allows the spores to germinate and grow fast and subsequently cause food poisoning. Food poisoning generally occurs as a result of poor hygiene and/or food handling practice. As almost all samples were held at room temperature for several hours before consumption, B. cereus was detected in all samples. Hence, it is important to educate food handlers about their responsibilities for food safety and train them on personal hygiene policies and basic practices for safe food handlings. Acknowledgement This study was supported by a Science Fund (Project No. 02-01-04-SF0390) from the Ministry of Science, Technology and Innovation, Malaysia and in part by a Grant-in-Aid for Scientific Research (KAKENHI 191010) from the Japan Society for the Promotion of Sciences.

References 
Ankolekar. C, Talat Rahmati, Ronald G. Labbe. 2009. Detection of toxigenic Bacillus cereus and Bacillus thuringiensis spores in U.S. rice. International Journal of Food Microbiology 128: 460–466. Ash, C., Farrow, J.A.E., Dorsch, M., Stackebrandt, E. and Collins, M.D. 1991a. Comparative analysis of Bacillus anthracis, Bacillus cereus and related species on the basis of reverse transcriptase sequencing of 16S rRNA. International Journal of Systematic Bacteriology 41: 343-346. Ash, C., Farrow, J.A.E., Wallbanks, S. and Collins, M.D. 1991b. Phylogenetic heterogeneity of the genus Bacillus revealed by comparative analysis of small subunit-ribosomal RNA sequences. Letters in Applied Microbiology 13: 202-206. Bach, H. J., Tomanova, J., Schloter, M. and Munch, J. 2002. Enumeration of total bacteria and bacteria with genes for proteolytic activity in pure cultures and in environmental samples by quantitative PCR mediated amplification. Journal of Microbiological Methods 49(3), 235-245. Bean, N.H., Griffin, P.M., Goulding, J.S and Ivey, C.B. 1990. Foodborne desease outbreaks, 5-year summary, 1983-1987. Journal of Food Protein 53: 711-728. Blodgett, R. 2006. Most Probable Number fromSerial Dilutions. Bacteriological Analytical Manual Online. AOAC International, Gaithersburg. Boyce, T.G., Koo, D., Swerdlow, D.L., Gomez, T.M., Serrano, B., Nickey, L.N., Hickman, B.M. and Griffin, P.M. 1996. Microorganisms associated with ready-toeat rice. Epidemiology and Infection 117(1): 29-34. Chang, H.J., Lee, J.H., Han, B.R., Kwak, T.K and Kim, J. 2011. Prevalence of the Levels of Bacillus cereus in Fried Rice Dishes and Its Exposure Assessment from Chinese-style Restaurants. Food Science and Biotechnology 20(5): 1351-1359. DOI 10.1007/ s10068-011-0186-3. Daanam, M., Mc Elroy., Lee-Ann, J. and Peggy, M.F. 1999. A Quantitative Risk Assessment For Bacillus cereus Emetic Disease Associated With The Consumption Of Chinese-Style Rice. Journal of Food Safety 19 (3): 209-229. Drobniewski, F.A. 1993. Bacillus cereus and related species. Clinical Microbiology 6: 324-338. Ehling-Schulz, M., Svensson, B., Guinebretiere, M.H., Lindback, T., Andersson, M., Schulz, A., Fricker, M., Christiansson, A., Granum, P.E., Martlbauer, E., Nguyen-The, C., Salkinoja-Salonen, M. and Scherer, S. 2005. Emetic toxin formation of Bacillus cereus is restricted to a single evolutionary lineage of closely related strains. Journal of Microbiology 151: 183– 197. Eilenberg, J., Damgaard, P.H., Hansen, B.M., Pedersen, J.C., Bresciani, J., and Larsson, R. 2000. Natural coprevalence of Strongwellsea castrans, Cystosporogenes deliaradicae, and Bacillus thuringiensis in the host, Delia radicum. Journal of Invertebrata Pathology 75: 69–75.836 Sandra, A., Afsah-Hejri, L., Tunung, R., Tuan T.C., Tang, J., Ghazali, F., Nakaguchi, Y., Nishibuchi, M and Son, R. International Food Research Journal 19(3): 829-836 Fang, T.J., Wei, Q.K., Liao, C.W., Hung, M.J, and Wang, T.H. 2003. Microbiological quality of 18 degrees C ready-to-eat food products sold in Taiwan. International Journal Food Microbiology 80: 241-250. Fatimah Bt Othman., Badrul Hisham B. Abd Samad., Akmalina Bte Hanafi. and Maziah Bte Md Noor. 2011. Johore Weekly Epidemiological Bulletin. Food and Drug Administration. Bad Bug Book: Foodborne Pathogenic Microorganisms and Natural Toxins Handbook Bacillus cereus and other Bacillus spp. United States. Grande, M.J., Lucas. R., Abriouel, H., Valdivia, E., Omar, N.B., Maqueda, M., Bueno, M.M., Martınez, M. and Galvez, A. 2006. Inhibition of toxicogenic Bacillus cereus in rice-based foods by enterocin AS-48. International Journal of Food Microbiology 106: 185 – 194. Granum, P.E. and Lund, T. 1997. Bacillus cereus and its food poisoning toxins. Federation of European Material Societies Microbiology Letters 157: 223–228. Granum, P.E. 2007. Bacillus cereus. In M.P. Doyle & L. R. Beuchat (Eds), Food microbiology fundamentals and frontiers 3rd edition, (pp: 445-455). Washington, DC, ASM Press. Guidelines for Assessing the Microbiological Safety of Ready-to-Eat Foods. 2009. London: Health Protection Agency, November 2009. Guinebretiere, M.H., Fabiano, L., Thompson, A.S., Philippe, N., Peter, D.M., Ehling-Schulz, Birgitta, S., Vincent, S., Christophe, N.T., Marc, H. and Paul, D.V. 2008. Ecological diversification in the Bacillus cereus Group. Environmental Microbiology 10(4): 851–865. Koo, K., Foegeding, P.M.N. and Swaisgood, H.E. 1998. Development of a streptavidin-conjugated singlechain antibody that binds Bacillus cereus spores. Applied Environment of Microbiology 64 (7): 2489- 2497. Lee, H.Y., Chai, L.C., Tang, S.Y., Jinap, S. and Ghazali, F.M. 2009. Application of MPN-PCR in biosafety of Bacillus cereus s.l. for ready-to-eat cereals. Food Control 20(11): 1068–1071. Lee, P.K., Buswell, J.A. and Shinagawa, K. 1995. Technical report: distribution of toxigenic Bacillus cereus in rice samples marketed in Hong Kong. World Journal of Microbiology and Biotechnology 11: 696–698. Little, C.L., Barnes, J. and Mitchell, RT. 2002. Microbiological quality of take-away cooked rice and chicken sandwiches: effectiveness of food hygiene training of the management. Communicable disease and public health/PHLS 5(4): 289-298. Mead, P.S., Slutsker, L., Dietz, V., McCaig, L.F., Bresee, J.S., Shapiro, C., Griffin, P.M. and Tauxe, R.V. 1999. Food-related illness and death in the United States. Emerging Infectious Disease 5(5): 607-625. Michael, L.M.D., John, P.D.V.M., Rachel, W.M.P.H. and Christopher, B.M.D. 2006. Surveillance for Foodborne Disease Outbreaks in United States, 1998-2002. CDC/ MMWR. 55(SS10): 1-34. Oh, M-H and Cox, J.M. 2010. Development and application of a centrifugation-plating method to study thebiodiversity of Bacillus species in rice products. Food Control 21: 7-12. Oh, M-H, Ham, J.S. and Cox, J.M. (2011). Diversity and toxigenicity among members of the Bacillus cereus group isolated from rice products. International Journal of Food Microbiology doi: 10.1016/j. ijfoodmicro.2011.09.018. Park, S.H., Kim, H.J., Kim, J.H., Kim, T.W and Kim, H.Y. 2007. Simultaneous detection and identification of Bacillus cereus group bacteria using multiplex PCR. Journal of Microbiology and Biotechnology 17(7):1177-82. Rampal, L., Jegathesan, M. and Lim, Y.S. 1984. An outbreak of Bacillus cereus food poisoning in a school hostel, Klang. TheMedical Journal of Malaysia 39(2): 116-122. Rhodehamel, E.J and Harmon, S.M. 2001. Bacteriological Analytical Manual. Chapter 14. Bacillus cereus. Rosenquist, H., Smidt, L., Andersen, S.R., Jensen, G.B. and Wilcks, A. 2005. Occurrence and significance of Bacillus cereus and Bacillus thuringiensis in ready-toeat food. FEMS Microbiology Letters 250: 129–136. Rusul G. and Yaacob, N.H. 1995. Prevalence of Bacillus cereus in selected foods and detection of enterotoxin using TECRA-VIA and BCET-RPLA. International Journal of Food Microbiology 25: 131-139. Shinagawa, K. 1993. Serology and characterization of Bacillus cereus in relation to toxin production. Bulletin of the International Dairy Federation 287: 42-49. Shoichi, I.E., Wesley F.P and Warren R.G. 1989. Rice in Asia: Is It Becoming an Inferior Good? American Journal of Agricultural Economics 71 (1): 32-42. Singleton, P. 2004. Bacteria in Biology, Biotechnology, and Medicine. 6th edition. In John Wiley and Sons (pp: 404). England. te Giffel, M. C., Beumer, R. R., Leijendekkers, S., and Rombouts, F. M. 1996. Incidence of Bacillus cereus and Bacillus subtilis in Foods in Netherlands. Food Microbiology 13: 53-58. The European Food Safety Agency Journal. 2005. Bacillus cereus and other Bacillus spp in foodstuffs. 175: 1-48, Todar, K. 2009. The Microbial World Lectures in Microbiology.http://textbookofbacteriology.net/ themicrobialworld/B.cereus.html. Department of Bacteriology. University of Wisconsin-Madison. Utusan online. 2011. 50% kes keracunan terjadi di kantin sekolah. http://www.utusan.com.my/ utusan/info.asp?y=2011&dt=0330&pub=Utusan_ Malaysia&sec=Terkini&pg=bt_20.htm.Acces on 29 January 2012. Yamada, S., Ohashi, E., Agata, N. and Venkateswaran, K. 1999. Cloning and nucleotide sequence analysis of gyrB of Bacillus cereus, B. thuringiensis, B. mycoides, and B. anthracis and their application to the detection of B. cereus in rice. Applied and Environmental Microbiology 65: 1483-1490.

Quantitative Analysis of Cereulide Toxin from Bacillus cereus in Rice and Pasta Using Synthetic Cereulide Standard and 13C6-Cereulide Standard—A Short Validation Study

1. Introduction

Cereulide toxine produced by Bacillus cereus, a Gram-positive bacteria, is a common cause of food poisoning [,]. The symptoms are characterized by nausea and vomiting that can be accompanied by diarrheal syndrome in approximately a third of the cases []. The intoxication may be severe and can lead to fatal outcomes [,,]. Although, the diarrheal part of the illness is caused by enterotoxins produced in the small intestine after ingestion of bacterial cells/spores, and not by cereulide, the combination of symptoms pronounces the seriousness of the illness []. The production of toxins has been observed as a bacterial response to the environmental conditions like pH, temperature, oxygen tension and high starch content in foods like rice and pasta dishes [,]. The cereulide toxin is as a cyclic dodecadepsipeptide with a molecular mass of 1.2 kDa and exceptional stability properties which make it difficult to inactivate in foods [,,]. These properties include the resistance to digestion enzymes like pepsin and trypsin, extreme pH conditions and even heat at temperatures of up to 150 °C []. The toxin is pre-formed in foods and is able to retain its biological toxic activity throughout the human acidic stomach environment and the digestion region.
The human toxic dose of cereulide has not been determined, but has been estimated from animal studies or in vitro experiments to be ~8 μg/kg body weight [,,,]. The lowest illness-inducing doses of cereulide toxin in foods that have been reported to now are at low nanogram level, ~5–10 ng of cereulide/g of foods [,]. At lower doses, cereulide might give rise to symptoms of milder nature or diffuse enough that might pass unrecorded.
Several types of detection methods for cereulide have been presented, among which a bioassay based on boar spermatozoa motility is reported to be one of the most easily performed [,]. Other methods include cytotoxicity based assays in cell cultures like rat liver cells [], HEP-2 cells [] or CHO (Chinese hamster ovary) cells []. Along with the difficulties to produce immunoassay based methods for cereulide toxin [], the bioassay based methods are known to suffer from interferences with molecules that have similar properties as the analyte of interest causing cross-reactivity and consequently luck of specificity for the analysis. Using chemical methods most of such issues can be circumvented. Several reports on successful quantitative analysis of cereulide using liquid chromatography coupled to mass or tandem mass spectrometry (LC-MS and MS/MS) have been presented [,,,]. However, as a synthetic cereulide standard has not been commercially available a surrogate standard, like the antibiotic valinomycin, had to be used as the best choice in previous studies where the content of cereulide in food samples was expressed in valinomycin equivalents. Recently, the synthetic cereulide standard was developed that has become commercially available and used in this study [].
In this report, we present a short in-house validation of a method using the novel synthetic cereulide standard together with 13C6-labeled cereulide as internal standard for quantitative analysis of cereulide toxin in rice and pasta samples with UPLC-ESI-MS/MS. This is, to the best of our knowledge, the first report on the quantitative MS analysis of cereulide using original standard. The usage of original standard eliminates possible ionization differences, due to matrix effects interferences in the ES-ionization step (like signal enhancement or suppression) [] that might exist when using surrogate standards. This, in combination with the benefits of the fragmentation in tandem mass spectrometry provides maximal specificity and increases the robustness and accuracy of the analysis. The presented method is easily performed and sensitive which together with its rapidness and specificity makes it be the best choice in emergent scenarios when it is important to distinguish the food-born disease caused by low levels of cereulide from B. cereus from other food intoxications that give similar symptoms, in order to protect human health.

2. Results and Discussion

2.1. Validation Design

To set-up and validate the UPLC-ESI-MS/MS method for quantitative analysis of cereulide toxin cooked rice and pasta samples of different types were prepared, pooled and spiked with cereulide toxin standard. For the quantitative analysis of cereulide a newly presented commercially available synthetic cereulide standard and 13C6-internal standard of cereulide were used [].

2.2. Calibration and Linearity

Linearity and possible matrix effects during the UPLC-MS/MS analysis were evaluated by comparing calibration curves prepared from the analysis of extracts of the pooled samples of each matrix and the methanol/water mixtures both spiked with cereulide at 0, 1, 5, 20, 100 and 500 ng/g. The derived calibration curves were linear in the tested concentration range (R2were for solvent/water: 1.000, pasta extract: 0.9999 and rice extract: 0.9998) and no evidence of matrix effects could be identified. The calibration curve of the cereulide standard was compared to the corresponding calibration curve of valinomycin (Figure 1). The diagram visualizes the difference in signal response between these two compounds, which, under the analytical conditions applied in the present method, would result in an underestimation of the cereulide content by a factor of two. Furthermore, as Figure 2 shows, the differences between cereulide and valinomycin are visible also in chromatography where these two compounds were compared at the same concentration and for the same product ion (m/z 172.15). This confirms the advantages of using the cereulide standard compared to valinomycin.
Figure 1
Comparison of calibration curves for cereulide standard and valinomycin. Area is plotted as a function of the concentration for each of the compounds.
Figure 2
MRM spectrum (multiple reaction monitoring-MRM) of the same product ions (m/z 172.15) for cereulide standard (B) and valinomycin (A) at a concentration of 100 ng/g. The peak annotations show the retention time and area.

2.3. Precision, Trueness and Recovery

The precision and trueness of the method were studied by quantitative analysis of pooled rice and pasta samples spiked at three different concentrations (1, 10 and 100 ng/g). The results were similar for both food types, with relative standard deviation (RSD) values ranging from 3% to 7% and bias values from −2% to +6% (Table 1). In another experiment, the possible influence on sample matrix variations on precision and trueness was investigated by spiking 21 different authentic food samples of rice and pasta, respectively. The RSD and bias values were within the ranges obtained for pooled samples, indicating that the method is robust towards sample matrix effects. The absolute extraction recovery, obtained from comparative analysis of samples spiked before and after extraction, was determined to be 91%–93%, not differing significantly between pasta and rice. The extraction losses will not influence the quantitative results of the method, as estimated by the trueness figures given above, since the internal standard used for quantification is added prior to extraction. The results from the experiments on precision, trueness and recovery are summarized in Table 1.
Table 1
Results from experiments on trueness, precision and extraction recovery.

2.4. LOD and LOQ

The limit of detection (LOD) for the method was experimentally determined by spiking blank rice and pasta with cereulide standard at 0.5, 0.1, 0.05 and 0.01 ng/g, and was found to be 0.1 ng/g. At this concentration level of cereulide all three confirmation fragments were visible and the fragment ion area quotients of the quantification fragments and of the two confirmation fragments were within the interval ±20% (see Table 2 for details) and with a S/N of ≥20 (calculated from the measurement of the peak-to-peak noise around the retention time of the analyte). Although the cereulide was not quantified on this level the same criteria for the peak identification was applied in order to retain the specificity of the detection. The limit of quantification (LOQ) for the method was set to 1 ng/g, defined as the lowest level at which acceptable precision and trueness was experimentally proven.
Table 2
The summary of the m/z values and parameter settings in the MS and MS/MS analysis. The product ions used as quantification fragments are indicated by bold figures.

2.5. Specificity

The specificity of the method was investigated using 21 blank food samples from each type of matrix that were analyzed regarding the presence of fragments associated with the cereulide toxin or the internal standard. The samples were from authentic cooked pasta or rice meals prepared in individual households or restaurants. In most cases they contained smaller amounts of other meal components, e.g., meat and tomato sauce. No interferences were found at the concentration levels ≥LOD in any of these samples. Based on these results, the method is considered as specific for cereulide toxin.

2.6. Incurred Samples

Finally, the method was tested under conditions similar to real food contamination by analysis of cereulide in blank food samples incubated with B. cereus. The food samples had been inoculated with cultures of three different strains of B. cereus and incubated for 48 h at 25 °C and 30 °C, where after the sample extracts were prepared and analyzed as described in Sample preparation and UPLC-MS/MS. Whereas there was no evidence of the cereulide presence in two of the incubated samples (SLV517 and SLV516), the third sample (CCUG52702) contained high amount of cereulide (beyond the highest validated concentration level of the method). This demonstrates the rapidness of the cereulide production process to concentrations far above the illness-inducing doses for humans that easily can be reached in very small amounts of foods when stored at ambient temperature. The two of the B. cereus inoculated samples in which the cereulide toxin was not found (SLV517 and SLV516) were presumably containing non-cereulide producing B. cereus strains that, on the other hand, might possess the ability to produce enterotoxins (diarrheal toxins), as these strains were isolated from samples suspected to cause the foodborne illness. However, this type of toxins cannot be identified with the present method.

3. Experimental Section

3.1. Chemicals and Materials

The synthetic cereulide peptide standard and the 13C6-labeled internal standard were purchased from Chiralix B. V. (Nijmegen, The Netherlands). Valinomycin was purchased from Sigma-Aldrich (Stockholm, Sweden). Acetonitrile was of LC-MS grade purchased from Fischer Scientific (Loughborough, Leicester, UK), and all other chemicals were of pro-analysis grade and obtained from Merck (Darmstadt, Germany). Water was purified with Milli-Q purification system (Millipore, Solna, Sweden). Stock solutions were prepared by dissolving cereulide standard in methanol. The solutions were stored at −20 °C until analysis when they were further diluted to prepare solutions at a concentration range of 0–500 ng/g.

3.2. Validation Samples

Pool samples of rice and pasta, respectively, were prepared by cooking raw products purchased at a local store according to the instructions on the packages, pooling the three different brands and homogenizing each pool in a mixer.
Individual samples of authentic food were donated from lunch boxes prepared by different persons. In total, 21 samples of rice and as many of pasta were collected. The samples contained mainly pasta or rice but also smaller amounts of sauce, fat and protein were included which was regarded as a robustness challenge for the method.
Spiked samples were prepared by adding cereulide dissolved in methanol to homogenized food samples. After mixing, the spiked sample was left at room temperature for 30 min for equilibration before extraction and analysis as described in the next sections. For determination of extraction recovery spiking was also done in blank sample extracts.
In order to test the usefulness of the method for the analysis of real samples contaminated with cereulide toxin producing strains of Bacillus cereus three different B. cereus strains were grown on blood agar plates (Oxoid, Basingstoke, UK). Two–three pure colonies of each of the bacteria strains, previously stored at −70 °C, were transferred and suspended in 10 mL of saline buffer (0.9% NaCl). From each of these suspensions 500 μL were used to contaminate 3 g portions of rice or pasta, respectively, and the samples were incubated in 25 °C and 30 °C during 48 h. Thereafter, the internal standard was added and the extraction procedure was applied for these samples and positive/negative control samples following the analysis and evaluation as described below.

3.3. Sample Extraction

Homogenized food samples (3 g) were placed in a sample tube and 13C6-Cereulide internal standard solution was added to a concentration of 10 ng/g (50 μL of a 0.6 μg/mL methanol solution). The extraction procedure was thereafter started by adding 15 mL of methanol and mixing samples for 30 s using a vortex mixer. The samples were then shaken for 15 min and centrifuged at 4000 × g for 15 min. Finally, 500 μL sample extract was mixed with 500 μL of water before injection in the UPLC-MS/MS system.

3.4. UPLC-ESI-MS/MS

Analysis was performed using an Acquity UPLC BEH C8 1.7 μm, 2.1 × 50 mm column and Waters UPLC I-Class (Waters, Milford, MA, USA) with Waters Xevo TQ-S mass spectrometer system (Waters) operating in ESI+ mode. The ionization parameters were set to: capillary voltage 3 kV, desolvation temperature 450 °C, desolvation gas flow rate 800 L/h, source temperature of 150 °C, cone gas flow rate 150 L/h, collision gas flow rate 0.15 mL/min and the collision gas pressure 3.5 ×10−3 mBar. The column temperature was maintained at 40 °C and the injection volume was 10 μL. The analysis was performed in multiple-reaction-monitoring mode and argon was used as the collision gas. Mobile phase gradient consisted of 1 mM ammonium formate in water containing 0.05% formic acid (A) and 0.05% formic acid in acetonitrile (B). The flow rate was set to 0.5 mL/min. The gradient started at 50% B for 1 min, linearly increased to 95% B over 3 min and kept at 95% B for 2 min and then reduced to 50% B over 0.1 min, following an equilibration period of 1 min. The highest abundant ions in MS1 were the ammonium adducts [M+NH4+] of the cereulide and the 13C6-cereulide internal standard corresponding to m/z 1170.7 and 1176.7 respectively, which were consequently selected as precursor ions. For identification and quantification in MS2 the product ions m/z1170.7→172.15 and 1176.7→172.15 were selected. Table 2 summarizes the details of the MS and MS/MS analysis. For quantitative analysis Targetlynx v 4.1 software (Waters, 2011) was applied. Solutions of cereulide (0, 1, 5, 20, 100 and 500 ng/g) in 50% methanol, all containing 13C6-cereulide at 10 ng/g, were injected to obtain calibration curves. These were constructed by plotting peak area ratios of cereulide to internal standard against concentration ratios of the analyte to the internal standard using linear regression.
For the confirmation of the analyte findings the quotients of areas of the quantification fragments and the two confirmation fragments were used which should not differ more than ±20% of the average for the quotients of the other calibration points in the curve. Additionally, the signal-to-noise ratio (S/N) has to be ≥20 in the positive control sample for all the fragments.

4. Conclusions

An in-house validation of a fast and straightforward UPLC-ESI-MS/MS method for qualitative and quantitative determination of cereulide toxin from Bacillus cereus is presented. The method is validated for food matrices based on rice and pasta, which stand for the vast majority of the food poisonings involving cereulide in the world. A, nowadays, commercially available synthetic cereulide standard and 13C6-labeled internal standard have been used being the ideal standards for quantitative MS analysis of cereulide toxin. Although, the robustness of the method is not evaluated in this study it is strengthened by use of the 13C6-cereulide internal standard, which enables revealing of possible robustness related method deviations. This involves the advantages of minimizing the risk of false negative results as well as it equalizes the prerequisites for optimal electrospray ionization and MS-detection of cereulide. The presented method is time and cost effective and easy to perform which together with its high sensitivity, specificity and precision makes it convenient to apply in emergent situations where it is important to reveal or reject the presence of the cereulide as the suspected causative agent in food poisonings in order to protect human health.

Acknowledgments

The Swedish Civil Contingencies Agency is gratefully acknowledged for the financial support. The authors would like to thank Åsa Rosengren for her help in the bacterial inoculation of samples.

Author Contributions

Author Contributions
Karl-Erik Hellenäs and Aida Zuberovic Muratovic conceived and designed experiments; Rikard Tröger complemented the design and performed experiments; Karl-Erik Hellenäs, Aida Zuberovic Muratovic, Rikard Tröger and Kristina Granelli analyzed the data; Aida Zuberovic Muratovic wrote the paper.

Conflicts of Interest

Conflicts of Interest
The authors declare no conflict of interest.

References

1. Kramer J.M., Gilbert R.J. Bacillus cereus and other Bacillus species. In: Doyle M.P., editor. Foodborne Bacterial Pathogens. Marcel Dekker; New York, NY, USA: 1989. pp. 21–70.
2. Stenfors Arnesen L.P., Fagerlund A., Granum P.E. From soil to gut: Bacillus cereus and its food poisoning toxins. FEMS Microbiol. Rev. 2008;32:579–606. [PubMed]
3. Opinion of the Scientific Panel on Biological Hazards on Bacillus cereus and other Bacillusspp. in foodstaffs. EFSA J. 2005;175:1–48. doi: 10.2903/j.efsa.2005.175. [Cross Ref]
4. Dierick K., van Coillie E., Swiecicka I., Meyfroidt G., Devlieger H., Meulemans A., Hoedemaekers G., Fourie L., Heyndrickx M., Mahillon J. Fatal family outbreak of Bacillus cereus-associated food poisoning. J. Clin. Microbiol. 2005;43:4277–4279.[PMC free article] [PubMed]
5. Mahler H., Pasi A., Kramer J.M., Schulte P., Scoging A.C., Bar W., Krahenbuhl S. Fulminant liver failure in association with the emetic toxin of Bacillus cereus. N. Engl. J. Med.1997;336:1142–1148. [PubMed]
6. Shiota M., Saitou K., Mizumoto H., Matsusaka M., Agata N., Nakayama M., Kage M., Tatsumi S., Okamoto A., Yamaguchi S. Rapid detoxification of cereulide in Bacillus cereusfood poisoning. Pediatrics. 2010;125:e951–e955. [PubMed]
7. Granum P.E., Lund T. Bacillus cereus and its food poisoning toxins. FEMS Microbiol. Lett. 1997;157:223–228. [PubMed]
8. Jääskeläinen E.L., Häggblom M.M., Andersson M.A., Salkinoja-Salonen M.S. Atmospheric oxygen and other conditions affecting the production of cereulide by Bacillus cereus in food. Int. J. Food Microbiol. 2004;96:75–83. [PubMed]
9. Agata N., Mori M., Ohta M., Suwan S., Ohtani I., Isobe M. A novel dodecadepsipeptide, cereulide, isolated from Bacillus cereus causes vacuole formation in HEp-2 cells. FEMS Microbiol. Lett. 1994;121:31–34. [PubMed]
10. Agata N., Ohta M., Mori M., Isobe M. A novel dodecadepsipeptide, cereulide, is an emetic toxin of Bacillus cereus. FEMS Microbiol. Lett. 1995;129:17–19. [PubMed]
11. Ehling-Schulz M., Fricker M., Scherer S. Bacillus cereus, the causative agent of an emetic type of food-borne illness. Mol. Nutr. Food Res. 2004;48:479–487. [PubMed]
12. Rajkovic A. Microbial toxins and low level of foodborne exposure. Trends Food Sci. Technol. 2014;38:149–157.
13. Andersson M.A., Hakulinen P., Honkalampi-Hämäläinen U., Hoornstra D., Lhuguenot J.-C., Mäki-Paakkanen J., Savolainen M., Severin I., Stammati A.-L., Turco L. Toxicological profile of cereulide, the Bacillus cereus emetic toxin, in functional assays with human, animal and bacterial cells. Toxicon. 2007;49:351–367. [PubMed]
14. Jääskeläinen E.L., Teplova V., Andersson M.A., Andersson L.C., Tammela P., Andersson M.C., Pirhonen T.I., Saris N.E.L., Vuorela P., Salkinoja-Salonen M.S. In vitroassay for human toxicity of cereulide, the emetic mitochondrial toxin produced by food poisoning Bacillus cereus. Toxicol. in Vitro. 2003;17:737–744. [PubMed]
15. Paananen A., Mikkola R., Sareneva T., Matikainen S., Hess M., Andersson M., Julkunen I., Salkinoja-Salonen M.S., Timonen T. Inhibition of human natural killer cell activity by cereulide, an emetic toxin from Bacillus cereus. Clin. Exp. Immunol. 2002;129:420–428.[PMC free article] [PubMed]
16. Delbrassinne L., Andjelkovic M., Rajkovic A., Dubois P., Nguessan E., Mahillon J., van Loco J. Determination of Bacillus cereus emetic toxin in food products by means of LC–MS2. Food Anal. Methods. 2012;5:969–979.
17. Naranjo M., Denayer S., Botteldoorn N., Delbrassinne L., Veys J., Waegenaere J., Sirtaine N., Driesen R.B., Sipido K.R., Mahillon J. Sudden death of a young adult associated with Bacillus cereus food poisoning. J. Clin. Microbiol. 2011;49:4379–4381.[PMC free article] [PubMed]
18. Andersson M.A., Mikkola R., Helin J., Andersson M.C., Salkinoja-Salonen M. A novel sensitive bioassay for detection of Bacillus cereus emetic toxin and related depsipeptide ionophores. Appl. Environ. Microbiol. 1998;64:1338–1343. [PMC free article] [PubMed]
19. Kawamura-Sato K., Hirama Y., Agata N., Ito H., Torii K., Takeno A., Hasegawa T., Shimomura Y., Ohta M. Quantitative analysis of cereulide, an emetic toxin of Bacillus cereus, by using rat liver mitochondria. Microbiol. Immunol. 2005;49:25–30. [PubMed]
20. Hughes S., Bartholomew B., Hardy J.C., Kramer J.M. Potential application of a HEp-2 cell assay in the investigation of Bacillus cereus emetic-syndrome food poisoning. FEMS Microbiol. Lett. 1988;52:7–11.
21. Beattie S.H., Williams A.G. Detection of toxigenic strains of Bacillus cereus and other Bacillus spp. with an improved cytotoxicity assay. Lett. Appl. Microbiol. 1999;28:221–225.[PubMed]
22. Bauer T., Stark T., Hofmann T., Ehling-Schulz M. Development of a stable isotope dilution analysis for the quantification of the Bacillus cereus toxin cereulide in foods. J. Agric. Food Chem. 2010;58:1420–1428. [PubMed]
23. Haggblom M.M., Apetroaie C., Andersson M.A., Salkinoja-Salonen M.S. Quantitative analysis of cereulide, the emetic toxin of Bacillus cereus, produced under various conditions.Appl. Environ. Microbiol. 2002;68:2479–2483. [PMC free article] [PubMed]
24. Shaheen R., Andersson M.A., Apetroaie C., Schulz A., Ehling-Schulz M., Ollilainen V.M., Salkinoja-Salonen M.S. Potential of selected infant food formulas for production ofBacillus cereus emetic toxin, cereulide. Int. J. Food Microbiol. 2006;107:287–294.[PubMed]
25. Biesta-Peters E.G., Reij M.W., Blaauw R.H., In ’t Veld P.H., Rajkovic A., Ehling-Schulz M., Abee T. Quantification of the emetic toxin cereulide in food products by liquid chromatography-mass spectrometry using synthetic cereulide as a standard. Appl. Environ. Microbiol. 2010;76:7466–7472. [PMC free article] [PubMed]
26. Zuberovic A. Doctoral Thesis. Uppsala University; Uppsala, Sweden: 2009. Surface Modified Capillaries in Capillary Electrophoresis Coupled to Mass Spectrometry: Method Development and Exploration of the Potential of Capillary Electrophoresis as a Proteomic Tool; p. 24

No comments:

Post a Comment